GRCh37/hg19 position | 12:103232178 |
GRCh38/hg38 position | 12:102838400 |
Alleles (ref/alt) | TTAC/- |
dbSNP rsid | rs551502562 |
Gene symbol |
PAH |
Most severe consequence | 3_prime_UTR_variant |
Flanking sequence | ATTTATACAGATTTGCTTTTCAATAATGTAT[TTAC/-]TTATTTATTCAGTGAACATTTCCTGAATATC |
HGVS |
NM_000277.3:c.*772_*775del NM_001354304.2:c.*772_*775del |
Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | |
NM_000277.3 | PAH | 13 | 3_prime_UTR_variant | c.*772_*775del | - | 3' UTR | ||
NM_001354304.2 | PAH | 14 | 3_prime_UTR_variant | c.*772_*775del | - | 3' UTR |
Database | Population | AC | AN | Hom | AF |
1000 genomes | ALL | 30 | 5008 | - | 0.00599042 |
EUR | - | - | - | 0 | |
EAS | - | - | - | 0 | |
SAS | - | - | - | 0 | |
AFR | - | - | - | 0.0197 | |
AMR | - | - | - | 0.0058 | |
gnomAD genomes | ALL | 162 | 30964 | 1 | 0.00523188 |
FIN | 0 | 3490 | 0 | 0 | |
NFE | 6 | 15008 | 0 | 0.000399787 | |
ASJ | 0 | 302 | 0 | 0 | |
EAS | 0 | 1618 | 0 | 0 | |
AFR | 153 | 8726 | 1 | 0.0175338 | |
AMR | 1 | 838 | 0 | 0.00119332 | |
OTH | 2 | 982 | 0 | 0.00203666 |
Method | Score | Level |
Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
---|---|---|---|---|---|---|---|---|
RCV000333803 | Uncertain significance | 2016-06-14 | criteria provided, single submitter | clinical testing | Phenylketonuria | PKU | - | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
Benign | Pathogenic | |||||
---|---|---|---|---|---|---|
Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
Functional data | BS3 | PP2 | PM1 | PS3 | ||
Segregation data | BS4 | PP1 | PP1 | PP1 | ||
De novo data | PM6 | PS2 | ||||
Allelic data | BP2 | PM3 | ||||
Other database | BP6 | PP5 | ||||
Other data | BP5 | PP4 |