| GRCh37/hg19 position | 10:43597793 |
| GRCh38/hg38 position | 10:43102345 |
| Alleles (ref/alt) | G/A |
| dbSNP rsid | rs76397662 |
| Gene symbol |
RET |
| Most severe consequence | missense_variant |
| Flanking sequence | CCCCCACAGACCTGACTTCTCTCTGCAGACC[G/A]CGGCTTTCCCCTGCTCACCGTCTACCTCAAG |
| HGVS |
NM_020630.6:c.341G>A NM_020975.6:c.341G>A NP_065681.1:p.Arg114His |
| Transcript | Gene | Exon number | Consequence | HGVS cDNA | HGVS protein | Location | Protein location | ||||
| NM_001355216.1 | RET | - | upstream_gene_variant | - | - | 2387 bp to transcript | |||||
| NM_020630.6 | RET | 19 | missense_variant | c.341G>A | p.Arg114His | Exon 3 |
|
||||
| NM_020975.6 | RET | 20 | missense_variant | c.341G>A | p.Arg114His | Exon 3 |
|
| Database | Population | AC | AN | Hom | AF |
| 1000 genomes | ALL | 7 | 5008 | - | 0.00139776 |
| EUR | - | - | - | 0 | |
| EAS | - | - | - | 0.006 | |
| SAS | - | - | - | 0.001 | |
| AFR | - | - | - | 0 | |
| AMR | - | - | - | 0 | |
| ExAC | ALL | 107 | 121326 | 1 | 0.000882 |
| FIN | 0 | 6614 | 0 | 0 | |
| NFE | 7 | 66686 | 0 | 0.000105 | |
| EAS | 98 | 8652 | 1 | 0.011327 | |
| SAS | 2 | 16512 | 0 | 0.000121 | |
| AFR | 0 | 10386 | 0 | 0 | |
| AMR | 0 | 11570 | 0 | 0 | |
| OTH | 0 | 906 | 0 | 0 | |
| gnomAD genomes | ALL | 24 | 30946 | 0 | 0.000775544 |
| FIN | 0 | 3492 | 0 | 0 | |
| NFE | 2 | 14988 | 0 | 0.00013344 | |
| ASJ | 0 | 302 | 0 | 0 | |
| EAS | 22 | 1620 | 0 | 0.0135802 | |
| AFR | 0 | 8724 | 0 | 0 | |
| AMR | 0 | 838 | 0 | 0 | |
| OTH | 0 | 982 | 0 | 0 | |
| gnomAD exomes | ALL | 188 | 245144 | 0 | 0.000766896 |
| FIN | 0 | 22094 | 0 | 0 | |
| NFE | 7 | 110828 | 0 | 6.31609e-05 | |
| ASJ | 0 | 9842 | 0 | 0 | |
| EAS | 175 | 17248 | 0 | 0.0101461 | |
| SAS | 6 | 30780 | 0 | 0.000194932 | |
| AFR | 0 | 15304 | 0 | 0 | |
| AMR | 0 | 33578 | 0 | 0 | |
| OTH | 0 | 5470 | 0 | 0 | |
| CONVERGE | ALL | - | - | - | 0.008 |
| HRC | ALL | 9 | 64976 | - | 0.000138513 |
| Tool | Score | Prediction |
|---|---|---|
| SIFT | 0.157 | tolerated |
| Polyphen2 HDIV | 0.007 | benign |
| Polyphen2 HVAR | 0.002 | benign |
| LRT | 0.116724 | neutral |
| MutationTaster | 0.00621181 | disease_causing_automatic |
| MutationAssessor | 0 | neutral |
| FATHMM | -1.2 | tolerated |
| MetaSVM | -0.6502 | tolerated |
| MetaLR | 0.1718 | tolerated |
| PROVEAN | -0.99 | neutral |
| CADD | 1.862061 | - |
| REVEL | 0.419 | - |
| Method | Score | Level |
| GERP++ | 4.82 | Conserved |
| phastCons46way primates | 0.010 | Not conserved |
| phastCons46way placental | 0.587 | Conserved |
| phastCons100way vertebrates | 0.653 | Conserved |
| phyloP46way primates | 0.655 | Conserved |
| phyloP46way placental | 2.214 | Conserved |
| phyloP100way vertebrates | 2.402 | Not conserved |
| Accession | Clinical significance | Date last evaluated | Review status | Method | Disease name | Disease symbol | Disease inheritance | Pubmed |
|---|---|---|---|---|---|---|---|---|
| RCV000121988 | Benign | 2017-01-05 | criteria provided, single submitter | reference population | not specified | - | - | |
| RCV001106778 | Likely benign | 2017-04-28 | criteria provided, single submitter | clinical testing | Renal hypodysplasia/aplasia 1 | RHDA1 | - | - |
| RCV000014974 | Uncertain significance | 2002-04-01 | no assertion criteria provided | literature only | Congenital central hypoventilation | - | - | |
| RCV001106779 | Benign | 2017-04-28 | criteria provided, single submitter | clinical testing | Multiple endocrine neoplasia | - | - | - |
| RCV000198261 | Benign | 2022-11-04 | criteria provided, single submitter | clinical testing | Multiple endocrine neoplasia, type 2 | MEN2 | - | |
| RCV001107412 | Benign | 2017-04-28 | criteria provided, single submitter | clinical testing | Pheochromocytoma | - | - | - |
| RCV000755684 | Benign | 2018-11-21 | criteria provided, single submitter | clinical testing | Multiple endocrine neoplasia, type 2b | MEN2B | - | |
| RCV000163885 | Benign | 2020-04-28 | criteria provided, multiple submitters, no conflicts | curation | Hereditary cancer-predisposing syndrome | - | - | |
| RCV000490359 | Benign | 2016-03-18 | criteria provided, single submitter | reference population | Hirschsprung disease, susceptibility to, 1 | - | - |
InterVar is a software tool for clinical interpretation of genetic variants by the ACMG/AMP 2015 guideline. The eveidence tags that variant met are highlighted. Please note that evidence tags with need to be evaluated manually.
| Benign | Pathogenic | |||||
|---|---|---|---|---|---|---|
| Strong | Supporting | Supporting | Moderate | Strong | Very Strong | |
| Population data | BA1 BS1 BS2 |
PM2 | PS4 | |||
| Computational and predictive data | BP1 BP3 BP4 BP7 |
PP3 | PM4 PM5 |
PS1 | PVS1 | |
| Functional data | BS3 | PP2 | PM1 | PS3 | ||
| Segregation data | BS4 | PP1 | PP1 | PP1 | ||
| De novo data | PM6 | PS2 | ||||
| Allelic data | BP2 | PM3 | ||||
| Other database | BP6 | PP5 | ||||
| Other data | BP5 | PP4 | ||||
The physichemical property of amino acid change.
| Trait | Arg (R) | His (H) |
| Amino acid name | Arginine | Histidine |
| Side chain class | basic | basic aromatic |
| Polarity | basic polar | basic polar |
| Charge (pH=7.4) | positively charged | positively or neutrally charged |
| Hydropathy | hydrophilic | moderate |
| Molecular weight | 174.203 | 155.156 |